EnhancerDB
  1. Home
  2. TFBS
  3. ZNF410[chr14:95767825-95767842]
Chromosome characteristics of ZNF410[chr14:95767825-95767842]
Back to top
Enhancers possibly regulated by ZNF410[chr14:95767825-95767842]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 95763616 95784199 enh3414
Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Liver Bone (Osteoblast) Blood (OCI-LY7) Stomach Placenta Thyroid Blood (Karpas-422) Lung (PC-9) Pancreas Pancreas (Panc1) Uterus Heart
SNP sites on ZNF410[chr14:95767825-95767842]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 95767830 rs74077857 A G 3754829
chr14 95767833 rs372814126 GAGGGATGCTGGCCTCCAGCC G 3754830
chr14 95767833 rs72297327 GAGGGATGCTGGCCTCCAGCC G 3754831
Genes possibly regulated by ZNF410[chr14:95767825-95767842]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF410[chr14:95767825-95767842]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results