Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100231166 100237187 enh31156

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100231262 rs199717300 G C 3784986
chr14 100231264 rs538508053 T TGTTGGTGTTGTTGTTGTTGTC 3784987
chr14 100231266 rs75900607 T C,G 3784988
chr14 100231272 rs369249927 T G 3784989

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results