EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr14:100231262-100231282]
Chromosome characteristics of RREB1[chr14:100231262-100231282]
Back to top
Enhancers possibly regulated by RREB1[chr14:100231262-100231282]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100231166 100237187 enh31156
Large Intestine Astrocyte Muscle (Myoblast) Pancreas Muscle (Myotube) Uterus Stomach
SNP sites on RREB1[chr14:100231262-100231282]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100231262 rs199717300 G C 3784986
chr14 100231264 rs538508053 T TGTTGGTGTTGTTGTTGTTGTC 3784987
chr14 100231266 rs75900607 T C,G 3784988
chr14 100231272 rs369249927 T G 3784989
Genes possibly regulated by RREB1[chr14:100231262-100231282]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr14:100231262-100231282]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results