Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100592993 100598387 enh99195

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100596570 rs559904129 TGTGTGTCTGCTCGCTGCAGCGG T 3787780

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results