EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2B[chr14:100677906-100677917]
Chromosome characteristics of TFAP2B[chr14:100677906-100677917]
Back to top
Enhancers possibly regulated by TFAP2B[chr14:100677906-100677917]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 100677385 100692855 enh3451
Bone Marrow (K562) Prostate (RWPE1) Bone (Osteoblast) Placenta Blood (Karpas-422) Uterus Thymus Stomach
SNP sites on TFAP2B[chr14:100677906-100677917]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 100677906 rs11625290 G C 3788492
chr14 100677911 rs546007526 TCAGGCTCTTCCCAGTGCCC T 3788493
Genes possibly regulated by TFAP2B[chr14:100677906-100677917]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2B[chr14:100677906-100677917]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results