EnhancerDB
  1. Home
  2. TFBS
  3. SOX4[chr14:101105601-101105617]
Chromosome characteristics of SOX4[chr14:101105601-101105617]
Back to top
Enhancers possibly regulated by SOX4[chr14:101105601-101105617]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 101102755 101149275 enh15944
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Stomach Brain (SK-N-SH) Bone (Osteoblast) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Spleen Liver (HepG2) Lung Muscle (A673) Heart
SNP sites on SOX4[chr14:101105601-101105617]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 101105608 rs567837237 TGCCAGGGGAGACAGGGGCAGCAAC T 3791173
chr14 101105612 rs569718866 A G 3791174
Genes possibly regulated by SOX4[chr14:101105601-101105617]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SOX4[chr14:101105601-101105617]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results