EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr14:101939546-101939566]
Chromosome characteristics of RREB1[chr14:101939546-101939566]
Back to top
Enhancers possibly regulated by RREB1[chr14:101939546-101939566]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 101936245 101949875 enh51938
Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Stomach Colon (HCT116) Breast Thyroid Pancreas Pancreas (Panc1) Uterus Epithelial (MCF-7)
SNP sites on RREB1[chr14:101939546-101939566]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 101939554 rs534204165 G GTGTGTGTGTGTGTGCGTGTGTA 3798414
chr14 101939554 rs56719428 G GTGTGTGTGTGTGTGCGTGTGTA 3798415
Genes possibly regulated by RREB1[chr14:101939546-101939566]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr14:101939546-101939566]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results