EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr14:103082543-103082563]
Chromosome characteristics of RREB1[chr14:103082543-103082563]
Back to top
Enhancers possibly regulated by RREB1[chr14:103082543-103082563]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103081225 103099435 enh3465
Bone Marrow (K562) Liver (HepG2) Brain (SK-N-MC) Large Intestine Bone (Osteoblast) Stomach Muscle (A673) Placenta Blood (Karpas-422) Lung (PC-9) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on RREB1[chr14:103082543-103082563]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103082543 rs66531927 ATGTGTGTGTGTGTGTGTGTGTGTG A,ATGTGTGTGTGTGTGTGTGTGTGTGTG 3806183
chr14 103082561 rs201112252 G A 3806184
chr14 103082563 rs202172986 G A 3806185
Genes possibly regulated by RREB1[chr14:103082543-103082563]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr14:103082543-103082563]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results