EnhancerDB
  1. Home
  2. TFBS
  3. IRF1[chr14:103166547-103166568]
Chromosome characteristics of IRF1[chr14:103166547-103166568]
Back to top
Enhancers possibly regulated by IRF1[chr14:103166547-103166568]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103148645 103166875 enh3467
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Esophagus Liver Blood (GM12878) Stomach Muscle (A673) Colon (HCT116) Blood (Karpas-422) Lung (PC-9) Neural Stem Cells (H9) Thymus Heart
SNP sites on IRF1[chr14:103166547-103166568]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103166561 rs181772448 T C 3807138
chr14 103166564 rs373525591 C CTTTTTCTTTTTTTGAGACAGAG 3807139
chr14 103166564 rs564133653 C CTTTTTCTTTTTTTGAGACAGAG 3807140
Genes possibly regulated by IRF1[chr14:103166547-103166568]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by IRF1[chr14:103166547-103166568]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results