Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103689565 103704655 enh51942

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103698956 rs200854402 GGGGCTGGGCAGCAGGAGGGCA G 3812073
chr14 103698963 rs567110398 G A 3812074

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results