Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104318405 104331075 enh15981

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104321930 rs149834061 CAGGCCGACTCCCACCCCACCCT C 3817195
chr14 104321936 rs184224593 G A 3817196

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results