EnhancerDB
  1. Home
  2. TFBS
  3. SNAI2[chr1:1004732-1004741]
Chromosome characteristics of SNAI2[chr1:1004732-1004741]
Back to top
Enhancers possibly regulated by SNAI2[chr1:1004732-1004741]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 992241 1006235 enh11407
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Placenta Colon (HCT116) Pancreas Thymus
chr1 1004646 1004986 vista15
VISTA
SNP sites on SNAI2[chr1:1004732-1004741]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 1004737 rs538252203 GGTGGGGGCGTGGCCCTGCGGGGCGTGGCCT G 2598
chr1 1004741 rs529180079 G C 2599
Genes possibly regulated by SNAI2[chr1:1004732-1004741]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 1006346 1009687 - RNF223 ENSG00000237330.2 1009687 0.97 1.0 4946 14
Expression level of Genes
Back to top
miRNAs possibly regulated by SNAI2[chr1:1004732-1004741]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results