Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 31622305 31630475 enh11709
chr1 31628220 31628457 vista1067

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 31628365 rs549432472 CCCACCCGCTTTGGGCCGCGCT C 209895

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results