Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 94525805 94540935 enh12065
chr1 94527681 94527931 vista2525

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 94527898 rs534106392 A C 492184
chr1 94527898 rs561968517 A AGCTACAACATCAACTCTTTTCCC 492185

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results