Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 82073905 82086695 enh31957

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 82074605 rs372656513 T TTACCTTTACCTTTACCTACTACAGGTA 4590535

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results