Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85030845 85038475 enh16859

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85035895 rs547353839 A ACGAGTGGAGTACGGAAAGG 4615623

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results