Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 47474705 47484575 enh29558

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 47483257 rs542185071 ATATATATATATATATATATG A 2608927
chr12 47483257 rs66663246 ATATATATATATATATATATG A 2608928

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results