Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 52218612 52224015 enh29576

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 52220646 rs545190944 TCACGTGAGTCTGAATACACACCAA T 2632834
chr12 52220647 rs375860711 C T 2632835
chr12 52220649 rs115964838 C T 2632836

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results