| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr12 | 63320465 | 63326755 | enh68155 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr12 | 63324486 | rs545936514 | G | GTCAGACTGTTGCTCCCCAAGGGCTTTATCAAATGAGCAAACCA | 2683112 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr12 | 63037762 | 63328817 | - | PPM1H | ENSG00000111110.7 | 63328817 | 0.89 | 0.99 | 4327 | 12282 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|