Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 67125744 67129894 enh68167
chr12 67127104 67129730 vista340

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 67128409 rs550833422 T TAAGATATTTTAAAATAAAC 2700244

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results