Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 68628335 68641815 enh29675

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 68629128 rs376937758 A AACAAACATATCACTCTGGTG 2709562
chr12 68629128 rs543787151 A AACAAACATATCACTCTGGTG 2709563

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results