Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 69487491 69504175 enh43765

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 69500930 rs142609315 ATAGAGAAACTCCTAAGACTGGGTAACTTATAAGG A 2715610
chr12 69500931 rs560424883 T A 2715611
chr12 69500933 rs572261771 G A 2715612

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results