EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2A[chr16:88151198-88151213]
Chromosome characteristics of TFAP2A[chr16:88151198-88151213]
Back to top
Enhancers possibly regulated by TFAP2A[chr16:88151198-88151213]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88148285 88157315 enh16900
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Placenta Pancreas Uterus Epithelial (MCF-7)
SNP sites on TFAP2A[chr16:88151198-88151213]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88151206 rs577756002 G A 4658535
chr16 88151213 rs547355668 G GTGGAGGTGCCACGTGCCTTCGGGGACCA 4658536
chr16 88151213 rs71156298 G GTGGAGGTGCCACGTGCCTTCGGGGACCA 4658537
Genes possibly regulated by TFAP2A[chr16:88151198-88151213]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2A[chr16:88151198-88151213]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results