Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 93993445 93999895 enh68235

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 93997215 rs145979802 GTACAGCCTAAGGCTACAGCC G 2813345
chr12 93997226 rs533629280 G A 2813346

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results