EnhancerDB
  1. Home
  2. TFBS
  3. POU3F2[chr12:95166172-95166184]
Chromosome characteristics of POU3F2[chr12:95166172-95166184]
Back to top
Enhancers possibly regulated by POU3F2[chr12:95166172-95166184]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 95152625 95167695 enh2521
Skin (Keratinocyte) Prostate (PC-3) Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Thyroid Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Muscle (Myotube) Uterus
SNP sites on POU3F2[chr12:95166172-95166184]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 95166176 rs190932418 T C 2822292
chr12 95166180 rs534109031 AAATACCTATTAAACATCTGGTG A 2822293
Genes possibly regulated by POU3F2[chr12:95166172-95166184]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POU3F2[chr12:95166172-95166184]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results