Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 96483745 96491215 enh58469

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 96486810 rs568729217 TATCAGGCTTCTGTACCAGACAAAGAAAG T 2831004

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results