Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88972289 rs560588204 G GACCCATGGCTGCCCTGGAC 4669668
chr16 88972289 rs577221417 G C 4669669

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results