EnhancerDB
  1. Home
  2. TFBS
  3. POU4F3[chr12:104981883-104981899]
Chromosome characteristics of POU4F3[chr12:104981883-104981899]
Back to top
Enhancers possibly regulated by POU4F3[chr12:104981883-104981899]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 104958166 105005515 enh2574
Bone Marrow (K562) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Kidney Epithelial (MCF-7) Stomach Ovary Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Heart
SNP sites on POU4F3[chr12:104981883-104981899]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 104981886 rs566550942 C A,T 2866231
chr12 104981887 rs532361430 A G 2866232
chr12 104981887 rs558121143 A ATGTAAAATTCACCCACTTTAAG 2866233
chr12 104981898 rs77205248 A G 2866234
Genes possibly regulated by POU4F3[chr12:104981883-104981899]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POU4F3[chr12:104981883-104981899]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results