EnhancerDB
  1. Home
  2. TFBS
  3. FOXB1[chr12:111133057-111133068]
Chromosome characteristics of FOXB1[chr12:111133057-111133068]
Back to top
Enhancers possibly regulated by FOXB1[chr12:111133057-111133068]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 111129577 111139820 enh14989
Bone Marrow (K562) Brain (SK-N-SH) Ovary Esophagus Blood (OCI-LY7) Lung (A549) Stomach Muscle (A673) Placenta Colon (HCT116) Pancreas Pancreas (Panc1) Uterus Heart
SNP sites on FOXB1[chr12:111133057-111133068]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 111133061 rs535424834 GTATATACACACACACACATA G 2898861
chr12 111133066 rs150777041 TAC T 2898862
chr12 111133066 rs759014555 TAC T 2898863
chr12 111133067 rs572879925 A G 2898864
Genes possibly regulated by FOXB1[chr12:111133057-111133068]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXB1[chr12:111133057-111133068]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results