EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr12:112026877-112026898]
Chromosome characteristics of ZNF263[chr12:112026877-112026898]
Back to top
Enhancers possibly regulated by ZNF263[chr12:112026877-112026898]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 112004625 112027035 enh14993
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Astrocyte Lung (A549) Stomach Muscle (A673) Placenta Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Pancreas (Panc1) Muscle (Myotube) Epithelial (MCF-7)
SNP sites on ZNF263[chr12:112026877-112026898]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 112026881 rs560367098 GGACGAGGCGGGTGGATCATCTAAGGTCAGGAGTTCGAGACCA G 2903076
Genes possibly regulated by ZNF263[chr12:112026877-112026898]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr12:112026877-112026898]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results