EnhancerDB
  1. Home
  2. TFBS
  3. MEIS2[chr12:117361944-117361952]
Chromosome characteristics of MEIS2[chr12:117361944-117361952]
Back to top
Enhancers possibly regulated by MEIS2[chr12:117361944-117361952]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 117350745 117365303 enh2616
Bone Marrow (K562) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Spleen Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on MEIS2[chr12:117361944-117361952]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 117361948 rs10774891 A C 2931540
chr12 117361951 rs67957560 GGTTGTCCATTTTCATGTTTTTAAGTCAGT G 2931541
chr12 117361951 rs72364381 GGTTGTCCATTTTCATGTTTTTAAGTCAGT G 2931542
Genes possibly regulated by MEIS2[chr12:117361944-117361952]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MEIS2[chr12:117361944-117361952]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results