EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2B[chr12:124881042-124881053]
Chromosome characteristics of TFAP2B[chr12:124881042-124881053]
Back to top
Enhancers possibly regulated by TFAP2B[chr12:124881042-124881053]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 124862183 124886902 enh2671
Astrocyte Adrenal Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Muscle (A673) Heart
SNP sites on TFAP2B[chr12:124881042-124881053]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 124881045 rs575863576 CCCCAGGCCCTACCAGCTGGATACAGTG C 2967995
Genes possibly regulated by TFAP2B[chr12:124881042-124881053]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2B[chr12:124881042-124881053]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 124821727 124821747 - hsa-miR-6880-3p MIMAT0027661 124873369 0.916667 0.0 7673 346
Expression level of miRNAs
Back to top