Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 124881045 rs575863576 CCCCAGGCCCTACCAGCTGGATACAGTG C 2967995

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 124821727 124821747 - hsa-miR-6880-3p MIMAT0027661 124873369 0.916667 0.0 7674 346