Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 125063773 125079595 enh30030

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 125068759 rs139912611 A AACAGCCACACTGCTGGTAGC 2970662
chr12 125068759 rs71092210 A AACAGCCACACTGCTGGTAGC 2970663

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results