Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 2554695 2574423 enh46303

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 2571295 rs569131485 G GCACACGCACAGGCGCGCACACACC 9583949

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results