Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 24838185 24848335 enh13063

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 24841474 rs373610826 TCACACCCCTCGAGGCCTCAC T 1270519
chr10 24841474 rs68005654 TCACACCCCTCGAGGCCTCAC T 1270520
chr10 24841476 rs547964813 ACACCCCTCGAGGCCT A 1270521

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results