Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 27085045 27097124 enh1144

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 27087857 rs546425137 G GCATGTACACATGTAACAAATCT 1279221

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results