Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 31346465 31355741 enh27970

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 31350976 rs529546977 AAAGTTCATTGCTGTGGAGAAC A 1312116

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results