Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 88609059 88634881 enh28312

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 88624839 rs373467337 G GTATCCCCTGTGACTTGCACATA 1555070
chr10 88624839 rs566391927 G GTATCCCCTGTGACTTGCACATA 1555071

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results