Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 89673825 89685235 enh1402

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 89677777 rs529165450 ACTCTGTTGCCCAGGCTGGAGTGCAGTG A 1559316

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results