Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 95794065 95808123 enh28369

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 95798496 rs539557726 CATACAATTCACCCAGTTAAGGT C 1589552

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results