Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 97982794 rs531651623 CATTATAAATACACATATATTTAT C 9973419
chr7 97982797 rs529179441 TATAA T 9973420

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results