EnhancerDB
  1. Home
  2. TFBS
  3. STAT1[chr7:101640232-101640247]
Chromosome characteristics of STAT1[chr7:101640232-101640247]
Back to top
Enhancers possibly regulated by STAT1[chr7:101640232-101640247]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 101610847 101660015 enh9950
Bone Marrow (K562) Astrocyte Colon (HCT116) Blood (Karpas-422) Uterus Epithelial (MCF-7) Kidney Brain (SK-N-SH) Blood (OCI-LY7) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on STAT1[chr7:101640232-101640247]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 101640247 rs369638779 G GCTCCCCTGCGCTCGTGTGCA 9990616
chr7 101640247 rs375162117 G GCTCCCCTGCGCTCGTGTGCA,GTGTGCA 9990617
Genes possibly regulated by STAT1[chr7:101640232-101640247]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by STAT1[chr7:101640232-101640247]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results