EnhancerDB
  1. Home
  2. TFBS
  3. ONECUT3[chr7:106369084-106369098]
Chromosome characteristics of ONECUT3[chr7:106369084-106369098]
Back to top
Enhancers possibly regulated by ONECUT3[chr7:106369084-106369098]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 106368496 106374355 enh49301
Skin (Keratinocyte) Prostate (PC-3) Esophagus Blood (OCI-LY7) Peripheral Blood (MM.1S) Spleen Thymus Stomach
SNP sites on ONECUT3[chr7:106369084-106369098]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 106369086 rs148389386 CAATTGATTTCCAACAAGGGAAATTTTTTCCCATTG C 10010939
chr7 106369086 rs60996104 CAATTGATTTCCAACAAGGGAAATTTTTTCCCATTG C 10010940
Genes possibly regulated by ONECUT3[chr7:106369084-106369098]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ONECUT3[chr7:106369084-106369098]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results