Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 107438225 107442475 enh89150

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 107440899 rs549968754 AGAAAATGATGTAAAGCCTTCATG A 10015663

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr7 107405912 107443670 - SLC26A3 ENSG00000091138.8 107443670 1.0 1.0 2756 7753


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results