Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 131330325 131341854 enh56489

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 131335925 rs191972205 C T 10096871
chr7 131335925 rs565393736 CTGTTCAGTAGTGTTAGTATATCTACAT C 10096872
chr7 131335933 rs551699166 T C,G 10096873

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results