Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 135769574 135774375 enh73040

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 135772845 rs56816080 CTGTGTGTGTGTGTGTGTGTGTGTGTGTG C 10118803
chr7 135772845 rs71989068 CTGTGTGTGTGTGTGTGTGTGTGTGTGTG C 10118804
chr7 135772851 rs11766948 G C 10118805

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results