EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:28183021-28183297]
Chromosome characteristics of ZNF274[chr1:28183021-28183297]
Back to top
Enhancers possibly regulated by ZNF274[chr1:28183021-28183297]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 28182518 28193279 enh179
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Lung Blood (GM12878) Stomach Placenta Thyroid Blood (Karpas-422) Lung (PC-9) Pancreas Blood (T-cell) Epithelial (MCF-7)
SNP sites on ZNF274[chr1:28183021-28183297]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 28183034 rs11806659 A G 188575
chr1 28183107 rs534537784 A T 188576
chr1 28183145 rs577940471 AGGGACACAGCCTGTCCCTATCTT A 188577
chr1 28183196 rs376796060 T C 188578
chr1 28183232 rs138136474 G A,C 188579
chr1 28183281 rs71642215 G C,T 188580
Genes possibly regulated by ZNF274[chr1:28183021-28183297]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:28183021-28183297]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results