Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 111752645 111768115 enh564
chr1 111759901 111760085 vista2948

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 111759879 rs145986640 CTGCTAATAGAACCCCTATT C 557227
chr1 111760061 rs79811607 G A 557228
chr1 111760127 rs2820076 T C 557229
chr1 111760132 rs2764547 C T 557230

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results