EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr1:114612657-114615953]
Chromosome characteristics of ZNF143[chr1:114612657-114615953]
Back to top
Enhancers possibly regulated by ZNF143[chr1:114612657-114615953]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 114615805 114628583 enh43027
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Esophagus Muscle (A673) Peripheral Blood (MM.1S) Embryonic Stem Cell Line (H1-hESC) Lung (PC-9) Muscle (Myotube) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF143[chr1:114612657-114615953]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 114612721 rs147807835 C T 572871
chr1 114612894 rs141229206 G T 572872
chr1 114612965 rs116746819 G A 572873
chr1 114613119 rs114598079 C G 572874
chr1 114613185 rs145240215 G A 572875
chr1 114613326 rs147604617 C G 572876
chr1 114613429 rs188112224 G A,T 572877
chr1 114613469 rs549719521 TCCCACACATCCCCATTCCAAGTTGCAGGGTCCC T 572878
chr1 114613496 rs140892277 G A 572879
chr1 114613500 rs181013756 C T 572880
chr1 114613502 rs186175454 C T 572881
chr1 114613552 rs514647 T C 572882
chr1 114613566 rs138632898 T G 572883
chr1 114613692 rs6690665 G A 572884
chr1 114613870 rs534059376 C T 572885
chr1 114613963 rs570656128 C T 572886
chr1 114614053 rs1847389 C A 572887
chr1 114614230 rs549514340 T C 572888
chr1 114614307 rs138321313 G C 572889
chr1 114614346 rs114533267 G A 572890
chr1 114614375 rs549986036 CAT C 572891
chr1 114614696 rs146127419 G A 572892
chr1 114614703 rs148343172 T A,C 572893
chr1 114614726 rs189840379 G A 572894
chr1 114614747 rs115438378 C T 572895
chr1 114614880 rs7520060 A G 572896
chr1 114614910 rs1503835 T C 572897
chr1 114614922 rs141508814 G T 572898
chr1 114615109 rs529171 C T 572899
chr1 114615616 rs75722498 G C 572900
chr1 114615626 rs369535114 C T 572901
chr1 114615669 rs534430641 G A 572902
chr1 114615710 rs139404154 A T 572903
Genes possibly regulated by ZNF143[chr1:114612657-114615953]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr1:114612657-114615953]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results