| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 116846225 | 116879811 | enh580 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 116848157 | rs542691447 | C | A | 587409 | |
| chr1 | 116848420 | rs187182128 | C | A,T | 587410 | |
| chr1 | 116848519 | rs536308130 | C | CTATATATATATACGTATATATATATATATACACATATATATATACA | 587411 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|